Electrical and Lighting Maintenance
Azzota Corp hcl lamp Ce 2in 51mm
2 (51mm) diameter Hollow Cathode Lamp for Perkin Elmer atomic absorption Cerium (Ce)
Azzota Corp hcl lamp Se 2in 51mm
2 (51mm) diameter Hollow Cathode Lamp for Perkin Elmer atomic absorption Selenium (Se)
Azzota Corp hcl lamp Na 2in 51mm
2 (51mm) diameter Hollow Cathode Lamp for Perkin Elmer atomic absorption Sodium (Na)
Cayman Chemical COX FluorScent InhIbItr Scr
Cayman’s COX Fluorescent Inhibitor Screening Assay provides a convenient fluorescence-based method for screening ovine COX-1 and human recombinant COX-2 for isozyme-specific inhibitors. The assay utilizes the peroxidase component of COXs. In this assay, the reaction between PGG2 and ADHP produces the highly fluorescent compound resorufin. Resorufin fluorescence can be analyzed with an excitation wavelength between 530-540 nm and an emission wavelength between 585-595 nm.
Cayman Chemical BRL 37344sodIum salt 25mg
A selective agonist of β3-adrenergic receptors with Ki values of 0.43, 9.17, and 37.9 µM for β3, β2, and β1, respectively
New England Biolabs, Inc. Control LAMP Primer Mix (rActin) - 50 rxns
The Control LAMP Primer Mix (rActin) targets actin RNA at an exon-exon junction. It is a LAMP primer set (F3 B3 FIP BIP LF LB) that amplifies rActin to ensure the absence of inhibition from human nucleic acid templates in a LAMP reaction. Control LAMP Primer Sequences rActin (5 3) rActin Primer Set Sequence ACTB-F3 AGTACCCCATCGAGCACG ACTB-B3 AGCCTGGATAGCAACGTACA ACTB-FIP GAGCCACACGCAGCTCATTGTATCACCAACTGGGACGACA ACTB-BIP CTGAACCCCAAGGCCAACCGGCTGGGGTGTTGAAGGTC ACTB-LF TGTGGTGCCAGATTTTCTCCA ACTB-LB CGAGAAGATGACCCAGATCATGT
Cayman Chemical DIfluorInated H2S FluorScent
A fluorescent probe for H2S; ex/em = 365/450 nm, respectively; selectively fluoresces in the presence of H2S over Zn2+, Fe3+, S2O32-, ClO-, SO32-, H2O2, NO2-, Cys, Hcy, and GSH at 1 µM
Cayman Chemical BRL 37344sodIum salt 10mg
A selective agonist of β3-adrenergic receptors with Ki values of 0.43, 9.17, and 37.9 µM for β3, β2, and β1, respectively